prsi9 u6 (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
prsi9 u6
Prsi9 U6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prsi9+u6/pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro+(Plasmid+%2328289)/pmc12537973-279-5-7
Average 93 stars, based on 31 article reviews
Prsi9 U6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prsi9+u6/pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro+(Plasmid+%2328289)/pmc12537973-279-5-7
Average 93 stars, based on 31 article reviews
prsi9 u6 - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Clone Assay:Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability Article Snippet: .. Short hairpin RNAs were cloned cloning into the pRSI9-U6-( Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability. Article Snippet: .. Short hairpin RNAs were cloned cloning into the pRSI9-U6-( Cloning:Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability Article Snippet: .. Short hairpin RNAs were cloned cloning into the pRSI9-U6-( Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability. Article Snippet: .. Short hairpin RNAs were cloned cloning into the pRSI9-U6-( Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability Article Snippet: .. Short hairpin RNA design and cloning into the pRSI9-U6-( Plasmid Preparation:Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability Article Snippet: .. Short hairpin RNAs were cloned cloning into the pRSI9-U6-( Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability. Article Snippet: .. Short hairpin RNAs were cloned cloning into the pRSI9-U6-( Article Title: Deep distributed computing to reconstruct extremely large lineage trees Article Snippet: .. For low copy number genomic DNA template preparation, 3.45 ng (approximately 1,000 copies) of human genomic DNA was resolved in 100 μl of PCR water containing 100 ng of pRSI9-U6-( Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability Article Snippet: .. Short hairpin RNA design and cloning into the pRSI9-U6-( shRNA:Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability Article Snippet: .. Short hairpin RNAs were cloned cloning into the pRSI9-U6-( Article Title: Cell cycle regulator MYBL2 is a distinct vulnerability in acute myeloid leukemia. Article Snippet: The sgRNA sequences were confirmed with Sanger sequencing (Eurofins Genomics). pL.EUP-CRISPRi: sgRNA #1 MYBL2 Top: CACCCACGCTGACGCCTTCGAGCG Bottom: AAACCGCTCGAAGGCGTCAGCGTG sgRNA #2 MYBL2 Top: CACCGGGCCCCGGGCCGCGCTCGA Bottom: AAACTCGAGCGCGGCCCGGGGCCC sgRNA luciferase Top: CACCAACGCCTTGATTGACAAGGA Bottom: AAACTCCTTGTCAATCAAGGCGTT pCRISPRia-v2: NTC Top: TTGGGCGATCTAATCGGAACTGGTTTAAGAGC Bottom: TTAGCTCTTAAACACAGTTCCGATTAGATCGCCCAACAAG sgRNA #2 MYBL2 Top: TTGGGGGCCCCGGGCCGCGCTCGAGTTTAAGAGC Bottom: TTAGCTCTTAAACTCGAGCGCGGCCCGGGGCCCCCAACAAG .. For shRNA knockdown sequences, the pRSI9-U6-( Article Title: Cell cycle regulator MYBL2 is a distinct vulnerability in acute myeloid leukemia Article Snippet: The sgRNA sequences were confirmed with Sanger sequencing (Eurofins Genomics). pL.EUP-CRISPRi: sgRNA #1 MYBL2 Top: CACCCACGCTGACGCCTTCGAGCG Bottom: AAACCGCTCGAAGGCGTCAGCGTG sgRNA #2 MYBL2 Top: CACCGGGCCCCGGGCCGCGCTCGA Bottom: AAACTCGAGCGCGGCCCGGGGCCC sgRNA luciferase Top: CACCAACGCCTTGATTGACAAGGA Bottom: AAACTCCTTGTCAATCAAGGCGTT pCRISPRia-v2: NTC Top: TTGGGCGATCTAATCGGAACTGGTTTAAGAGC Bottom: TTAGCTCTTAAACACAGTTCCGATTAGATCGCCCAACAAG sgRNA #2 MYBL2 Top: TTGGGGGCCCCGGGCCGCGCTCGAGTTTAAGAGC Bottom: TTAGCTCTTAAACTCGAGCGCGGCCCGGGGCCCCCAACAAG .. For shRNA knockdown sequences, the pRSI9-U6-( Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability. Article Snippet: .. Short hairpin RNAs were cloned cloning into the pRSI9-U6-( Article Title: Sirt3 Regulates Proliferation and Progesterone Production in Leydig Cells via Suppression of Reactive Oxygen Species. Article Snippet: Sirt3 is a mitochondrial protein deacetylase functioning in energy metabolism, regulation of intracellular reactive oxygen species (ROS) levels, and aging.. Although Sirt3 loss has negative effects on fertility of oocytes during in vitro fertilization and on progesterone production in granulosa cells, Sirt3’s function in Leydig cells remains unclear.. Therefore, we investigated Sirt3 activity in Leydig cells, focusing on androgen production. Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability Article Snippet: .. Short hairpin RNA design and cloning into the pRSI9-U6-( Expressing:Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability Article Snippet: .. Short hairpin RNAs were cloned cloning into the pRSI9-U6-( Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability. Article Snippet: .. Short hairpin RNAs were cloned cloning into the pRSI9-U6-( Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability Article Snippet: .. Short hairpin RNA design and cloning into the pRSI9-U6-( Knockdown:Article Title: Cell cycle regulator MYBL2 is a distinct vulnerability in acute myeloid leukemia. Article Snippet: The sgRNA sequences were confirmed with Sanger sequencing (Eurofins Genomics). pL.EUP-CRISPRi: sgRNA #1 MYBL2 Top: CACCCACGCTGACGCCTTCGAGCG Bottom: AAACCGCTCGAAGGCGTCAGCGTG sgRNA #2 MYBL2 Top: CACCGGGCCCCGGGCCGCGCTCGA Bottom: AAACTCGAGCGCGGCCCGGGGCCC sgRNA luciferase Top: CACCAACGCCTTGATTGACAAGGA Bottom: AAACTCCTTGTCAATCAAGGCGTT pCRISPRia-v2: NTC Top: TTGGGCGATCTAATCGGAACTGGTTTAAGAGC Bottom: TTAGCTCTTAAACACAGTTCCGATTAGATCGCCCAACAAG sgRNA #2 MYBL2 Top: TTGGGGGCCCCGGGCCGCGCTCGAGTTTAAGAGC Bottom: TTAGCTCTTAAACTCGAGCGCGGCCCGGGGCCCCCAACAAG .. For shRNA knockdown sequences, the pRSI9-U6-( Article Title: Cell cycle regulator MYBL2 is a distinct vulnerability in acute myeloid leukemia Article Snippet: The sgRNA sequences were confirmed with Sanger sequencing (Eurofins Genomics). pL.EUP-CRISPRi: sgRNA #1 MYBL2 Top: CACCCACGCTGACGCCTTCGAGCG Bottom: AAACCGCTCGAAGGCGTCAGCGTG sgRNA #2 MYBL2 Top: CACCGGGCCCCGGGCCGCGCTCGA Bottom: AAACTCGAGCGCGGCCCGGGGCCC sgRNA luciferase Top: CACCAACGCCTTGATTGACAAGGA Bottom: AAACTCCTTGTCAATCAAGGCGTT pCRISPRia-v2: NTC Top: TTGGGCGATCTAATCGGAACTGGTTTAAGAGC Bottom: TTAGCTCTTAAACACAGTTCCGATTAGATCGCCCAACAAG sgRNA #2 MYBL2 Top: TTGGGGGCCCCGGGCCGCGCTCGAGTTTAAGAGC Bottom: TTAGCTCTTAAACTCGAGCGCGGCCCGGGGCCCCCAACAAG .. For shRNA knockdown sequences, the pRSI9-U6-( Low Copy Number:Article Title: Deep distributed computing to reconstruct extremely large lineage trees Article Snippet: .. For low copy number genomic DNA template preparation, 3.45 ng (approximately 1,000 copies) of human genomic DNA was resolved in 100 μl of PCR water containing 100 ng of pRSI9-U6-( Polymerase Chain Reaction:Article Title: Deep distributed computing to reconstruct extremely large lineage trees Article Snippet: .. For low copy number genomic DNA template preparation, 3.45 ng (approximately 1,000 copies) of human genomic DNA was resolved in 100 μl of PCR water containing 100 ng of pRSI9-U6-( Transduction:Article Title: Monocyte compositions and methods for the treatment of infectious disease Article Snippet: .. Lineage tracing experiment: Primary GMPs from C57BL/6-Tg(UBC-GFP)30Schaa (004353, Jackson) or C57BL/6-CD45.1(STEM) (Mercier et al., 2016) were sorted followed by transduction with a high-complexity barcode library, pRSI9-U6-( |